Stem-loop sequence ath-MIR447b

AccessionMI0002408 (change log)
DescriptionArabidopsis thaliana miR447b stem-loop
Gene family MIPF0000170; MIR447
Literature search

3 open access papers mention ath-MIR447b
(17 sentences)

Stem-loop
                c        uu    a     u  u      aca         a            -      ug   --u    uucgagcuugguguguuuuucuagccagcc 
5' cauucuuaauaua aauacuac  uuuc uccau aa ccccuu   augucgagu aacgaagcaucu gucccc  gua   uguc                              c
   ||||||||||||| ||||||||  |||| ||||| || ||||||   ||||||||| |||||||||||| ||||||  |||   ||||                              c
3' guaagaguuauau uuaugaug  aaag aggua uu ggggaa   uauagcuca uuguuuuguaga cagggg  uau   acag                              a
                a        uu    a     u  c      gaa         g            g      uu   uac    ucuuauguuuguuacuaguugagcucuuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 1535426-1535661 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR447b
ath-MIR447bchr4: 1535426-1535661 [-]
ath-MIR447achr4: 1528134-1528370 [-]
Database links

Mature sequence ath-miR447b

Accession MIMAT0002114
Sequence

159 - 

uuggggacgagauguuuuguug

 - 180

Get sequence
Evidence experimental; cloned [1-2], 5'RACE [2], 454 [3], Illumina [4]

References

1
PMID:15851028 "microRNA-directed phasing during trans-acting siRNA biogenesis in plants" Allen E, Xie Z, Gustafson AM, Carrington JC Cell. 121:207-221(2005).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).