Stem-loop sequence ath-MIR447a

AccessionMI0002407 (change log)
DescriptionArabidopsis thaliana miR447a stem-loop
Gene family MIPF0000170; MIR447
Literature search

4 open access papers mention ath-MIR447a
(20 sentences)

Stem-loop
         ua              uu    a     u  a      aca         a            -      ug   u      cgagcuugguguuuuuuucuagccaacucc 
5' cauucu  auauauaauacuac  uuuc uccau aa ccccuu   augucgagu aacgaagcaucu gucccc  gua ugucuu                              a
   ||||||  ||||||||||||||  |||| ||||| || ||||||   ||||||||| |||||||||||| ||||||  ||| ||||||                               
3' gugaga  uauauauuaugaug  aaag aggua uu ggggaa   uauagcuca uuguuuuguaga cagggg  uau acagag                              a
         gc              uu    a     u  c      gaa         g            g      uu   u      uucuuauguuuguuacuaguugagcucuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr4: 1528134-1528370 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR447a
ath-MIR447bchr4: 1535426-1535661 [-]
ath-MIR447achr4: 1528134-1528370 [-]
ath-MIR447cchr4: 1523306-1523503 [-]
Database links

Mature sequence ath-miR447a-3p

Accession MIMAT0002113
Previous IDsath-miR447a
Sequence

160 - 

uuggggacgagauguuuuguug

 - 181

Get sequence
Evidence experimental; cloned [1-2], 5'RACE [2], 454 [3], Illumina [4]

Mature sequence ath-miR447a.2-3p

Accession MIMAT0020345
Previous IDsath-miR447a.2
Sequence

203 - 

uauggaagaaauuguaguauu

 - 223

Get sequence
Evidence experimental; Illumina [5]

References

1
PMID:15851028 "microRNA-directed phasing during trans-acting siRNA biogenesis in plants" Allen E, Xie Z, Gustafson AM, Carrington JC Cell. 121:207-221(2005).
2
PMID:16040653 "Expression of Arabidopsis MIRNA genes" Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC Plant Physiol. 138:2145-2154(2005).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).
4
PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis" Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW J Exp Bot. 61:165-177(2010).
5
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).