Stem-loop sequence mmu-mir-471

AccessionMI0002406 (change log)
Symbol MGI:Mir471
DescriptionMus musculus miR-471 stem-loop
Gene family MIPF0000423; mir-471
Literature search

4 open access papers mention mmu-mir-471
(166 sentences)

Stem-loop
   gug  u          a ug        a  aa 
5'    cu uacguaguau g  cuuuucac uu  a
      || |||||||||| |  |||||||| ||   
3'    ga auguaucaua c  ggaaagug aa  c
   -ag  u          c gu        a  aa 
Get sequence
Deep sequencing
4695 reads, 234 reads per million, 35 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66792595-66792661 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-471
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
mmu-mir-463chrX: 66799223-66799297 [-]
mmu-mir-741chrX: 66796805-66796875 [-]
mmu-mir-471chrX: 66792595-66792661 [-]
mmu-mir-883bchrX: 66789890-66789967 [-]
Database links

Mature sequence mmu-miR-471-5p

Accession MIMAT0002112
Previous IDsmmu-miR-471
Sequence

7 - 

uacguaguauagugcuuuucac

 - 28

Get sequence
Deep sequencing3092 reads, 28 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-471-3p

Accession MIMAT0017195
Sequence

42 - 

ugaaaggugccauacuauguau

 - 63

Get sequence
Deep sequencing1603 reads, 33 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).