Stem-loop sequence mmu-mir-470

AccessionMI0002405 (change log)
Symbol MGI:Mir470
DescriptionMus musculus miR-470 stem-loop
Gene family MIPF0000386; mir-743
Literature search

11 open access papers mention mmu-mir-470
(20 sentences)

Stem-loop
   ----cag         ug  cu  c      -ga   aa 
5'        ugcucuucu  ga  gg acuggu   guu  a
          |||||||||  ||  || ||||||   |||   
3'        augagaaga  cu  cc ugacca   uaa  c
   acucgaa         gu  uu  a      aca   au 
Get sequence
Deep sequencing
236583 reads, 2e+03 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66813951-66814025 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-470
mmu-mir-465dchrX: 66822656-66822713 [-]
mmu-mir-470chrX: 66813951-66814025 [-]
mmu-mir-871chrX: 66810428-66810504 [-]
Database links

Mature sequence mmu-miR-470-5p

Accession MIMAT0002111
Previous IDsmmu-miR-470
Sequence

9 - 

uucuuggacuggcacuggugagu

 - 31

Get sequence
Deep sequencing235203 reads, 52 experiments
Evidence experimental; cloned [1-3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-470-3p

Accession MIMAT0004760
Previous IDsmmu-miR-470*
Sequence

44 - 

aaccaguaccuuucugagaaga

 - 65

Get sequence
Deep sequencing1377 reads, 24 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).