Stem-loop sequence mmu-mir-468

AccessionMI0002403 (change log)
Symbol MGI:Mir468
DescriptionMus musculus miR-468 stem-loop
Literature search

5 open access papers mention mmu-mir-468
(11 sentences)

Stem-loop
   -aua   a  uug   ug  -  g c  a gu     uaa 
5'     aga ac   gcg  uc gu a ug u  acuga   g
       ||| ||   |||  || || | || |  |||||    
3'     ucu ug   cgu  ag ca u au g  ugacu   a
   ucug   g  -ug   gu  u  g -  a ug     caa 
Get sequence
Deep sequencing
6207 reads, 379 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The pattern of reads from deep sequencing experiments that map to the mir-468 locus suggests this annotation is dubious. The entry may be removed in future releases.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 81896599-81896676 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-468
mmu-mir-468chr6: 81896599-81896676 [-]
mmu-mir-7232chr6: 81895590-81895663 [-]
Database links

Mature sequence mmu-miR-468-5p

Accession MIMAT0022699
Sequence

22 - 

gacugauguacugauaagaaacucagu

 - 48

Get sequence
Deep sequencing2954 reads, 17 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence mmu-miR-468-3p

Accession MIMAT0002109
Previous IDsmmu-miR-468
Sequence

53 - 

uaugacugaugugcgugugucug

 - 75

Get sequence
Deep sequencing366 reads, 17 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1