Stem-loop sequence mmu-mir-467a-1

AccessionMI0002402 (change log)
Previous IDsmmu-mir-467;mmu-mir-467a
Symbol MGI:Mir467a-1
DescriptionMus musculus miR-467a-1 stem-loop
Gene family MIPF0000316; mir-467
Literature search

26 open access papers mention mmu-mir-467a-1
(105 sentences)

Stem-loop
   c      c   a   cc  c             ua 
5'  ugugug gua gug  ug auguauaugcgug  u
    |||||| ||| |||  || |||||||||||||  a
3'  acacac cau cac  ac uacauauacguau  u
   u      a   c   ac  a             uu 
Get sequence
Deep sequencing
95777 reads, 391 reads per million, 112 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The sequence of miR-467 is of low complexity. The sequence maps exactly to several genomic positions, and many more with 1 or 2 substitutions. Confidence in this miRNA might therefore be reduced.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10476346-10476418 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-467a-1
mmu-mir-466mchr2: 10466663-10466746 [+]
mmu-mir-466f-1chr2: 10466944-10467037 [+]
mmu-mir-669fchr2: 10467229-10467349 [+]
mmu-mir-669echr2: 10467495-10467613 [+]
mmu-mir-669bchr2: 10467790-10467886 [+]
mmu-mir-669dchr2: 10468343-10468463 [+]
mmu-mir-466f-2chr2: 10468675-10468768 [+]
mmu-mir-669lchr2: 10468971-10469068 [+]
mmu-mir-669d-2chr2: 10471644-10471729 [+]
mmu-mir-466f-3chr2: 10471953-10472046 [+]
mmu-mir-297a-2chr2: 10472254-10472343 [+]
mmu-mir-466ochr2: 10472540-10472623 [+]
mmu-mir-467cchr2: 10473931-10474027 [+]
mmu-mir-466b-1chr2: 10474219-10474300 [+]
mmu-mir-669a-3chr2: 10474433-10474541 [+]
mmu-mir-669kchr2: 10475300-10475426 [+]
mmu-mir-467a-1chr2: 10476346-10476418 [+]
mmu-mir-466b-8chr2: 10476628-10476713 [+]
mmu-mir-669a-1chr2: 10476853-10476949 [+]
mmu-mir-669gchr2: 10477150-10477272 [+]
mmu-mir-669jchr2: 10477910-10478030 [+]
mmu-mir-467a-2chr2: 10478798-10478880 [+]
mmu-mir-466echr2: 10479088-10479171 [+]
mmu-mir-669a-4chr2: 10479315-10479401 [+]
mmu-mir-467bchr2: 10481248-10481320 [+]
mmu-mir-466c-1chr2: 10481534-10481617 [+]
mmu-mir-669a-5chr2: 10481761-10481847 [+]
mmu-mir-467a-3chr2: 10483678-10483760 [+]
mmu-mir-466c-2chr2: 10483966-10484055 [+]
mmu-mir-669a-6chr2: 10484196-10484282 [+]
mmu-mir-467a-4chr2: 10486135-10486217 [+]
Database links

Mature sequence mmu-miR-467a-5p

Accession MIMAT0003409
Previous IDsmmu-miR-467*;mmu-miR-467a
Sequence

10 - 

uaagugccugcauguauaugcg

 - 31

Get sequence
Deep sequencing801150 reads, 101 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-467a-3p

Accession MIMAT0002108
Previous IDsmmu-miR-467;mmu-miR-467a;mmu-miR-467a*;mmu-miR-467a-1*;mmu-miR-467a*
Sequence

45 - 

cauauacauacacacaccuaca

 - 66

Get sequence
Deep sequencing156500 reads, 99 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).