Stem-loop sequence mmu-mir-466a

AccessionMI0002401 (change log)
Previous IDsmmu-mir-466
DescriptionMus musculus miR-466a stem-loop
Gene family MIPF0000208; mir-466
Literature search

28 open access papers mention mmu-mir-466a
(122 sentences)

Stem-loop
   --ua       uua          c   --  -     g 
5'     uaugugu   ugugugugua aug  ua cauau u
       |||||||   |||||||||| |||  || |||||  
3'     auacaca   gcacauacau uac  au guaua g
   caga       --c          a   cu  a     a 
Get sequence
Deep sequencing
27401 reads, 117 reads per million, 103 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 10507918-10507990 [+]
sense
OTTMUST00000026263 ; Sfmbt2-001; intron 10
ENSMUST00000041105 ; Sfmbt2-001; intron 10
ENSMUST00000116594 ; Sfmbt2-201; intron 11
Clustered miRNAs
< 10kb from mmu-mir-466a
mmu-mir-467a-9chr2: 10498393-10498475 [+]
mmu-mir-466b-2chr2: 10498685-10498766 [+]
mmu-mir-669a-10chr2: 10498911-10498997 [+]
mmu-mir-669a-11chr2: 10501339-10501425 [+]
mmu-mir-467a-10chr2: 10503273-10503355 [+]
mmu-mir-466b-3chr2: 10503565-10503645 [+]
mmu-mir-669a-12chr2: 10503791-10503877 [+]
mmu-mir-467echr2: 10505721-10505807 [+]
mmu-mir-466pchr2: 10506006-10506094 [+]
mmu-mir-467dchr2: 10507630-10507714 [+]
mmu-mir-466achr2: 10507918-10507990 [+]
mmu-mir-297cchr2: 10509016-10509113 [+]
mmu-mir-669cchr2: 10509296-10509404 [+]
mmu-mir-669a-2chr2: 10510164-10510260 [+]
mmu-mir-297bchr2: 10511667-10511775 [+]
mmu-mir-466dchr2: 10511967-10512062 [+]
mmu-mir-669m-1chr2: 10512790-10512887 [+]
mmu-mir-669m-2chr2: 10513434-10513531 [+]
mmu-mir-466nchr2: 10513741-10513834 [+]
mmu-mir-669ochr2: 10514300-10514395 [+]
mmu-mir-466gchr2: 10514595-10514674 [+]
mmu-mir-466hchr2: 10514891-10514971 [+]
mmu-mir-297a-3chr2: 10515820-10515921 [+]
mmu-mir-466lchr2: 10516097-10516217 [+]
mmu-mir-297a-4chr2: 10517067-10517164 [+]
mmu-mir-669ichr2: 10517604-10517730 [+]
Database links

Mature sequence mmu-miR-466a-5p

Accession MIMAT0004759
Sequence

11 - 

uauguguguguacauguacaua

 - 32

Get sequence
Deep sequencing4221 reads, 83 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-466a-3p

Accession MIMAT0002107
Previous IDsmmu-miR-466
Sequence

50 - 

uauacauacacgcacacauaaga

 - 72

Get sequence
Deep sequencing23174 reads, 102 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).