Stem-loop sequence mmu-mir-465a

AccessionMI0002400 (change log)
Previous IDsmmu-mir-465
DescriptionMus musculus miR-465a stem-loop
Gene family MIPF0000384; mir-465
Literature search

7 open access papers mention mmu-mir-465a
(29 sentences)

Stem-loop
   ----   -----          u   a     g    aaaa 
5'     gcc     cuauuuagaa ggc cugau ugau    u
       |||     |||||||||| ||| ||||| ||||     
3'     cgg     gaugaaucuu ccg gacua guua    a
   cauu   aauga          u   g     -    aaaa 
Get sequence
Deep sequencing
279813 reads, 2.28e+03 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Yu et al. identified a mature miRNA product from the 5' arm of this precursor, renamed miR-465a-5p here [1]. Watanabe et al. later reported a 3' miRNA product [2].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66839052-66839125 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-465a
mmu-mir-465achrX: 66839052-66839125 [-]
mmu-mir-465b-2chrX: 66835764-66835842 [-]
mmu-mir-465c-2chrX: 66832517-66832597 [-]
mmu-mir-465b-1chrX: 66829202-66829280 [-]
Database links

Mature sequence mmu-miR-465a-5p

Accession MIMAT0002106
Previous IDsmmu-miR-465;mmu-miR-465-5p
Sequence

5 - 

uauuuagaauggcacugauguga

 - 27

Get sequence
Deep sequencing84644 reads, 50 experiments
Evidence experimental; cloned [1,3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-465a-3p

Accession MIMAT0004217
Previous IDsmmu-miR-465-3p
Sequence

42 - 

gaucagggccuuucuaaguaga

 - 63

Get sequence
Deep sequencing195164 reads, 51 experiments
Evidence experimental; cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

1
2
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).