Stem-loop sequence mmu-mir-463

AccessionMI0002398 (change log)
Symbol MGI:Mir463
DescriptionMus musculus miR-463 stem-loop
Gene family MIPF0000425; mir-463
Literature search

7 open access papers mention mmu-mir-463
(11 sentences)

Stem-loop
   -----------        a  u  u    ---      guaa 
5'            cuuuaccu au ug uguc   caucau    a
              |||||||| || || ||||   ||||||    a
3'            gagaugga ua ac acag   guagua    c
   ucacuuggaag        a  u  c    aua      aaua 
Get sequence
Deep sequencing
24202 reads, 480 reads per million, 30 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 66799223-66799297 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-463
mmu-mir-881chrX: 66801944-66802021 [-]
mmu-mir-878chrX: 66801508-66801585 [-]
mmu-mir-880chrX: 66800530-66800607 [-]
mmu-mir-463chrX: 66799223-66799297 [-]
mmu-mir-741chrX: 66796805-66796875 [-]
mmu-mir-471chrX: 66792595-66792661 [-]
mmu-mir-883bchrX: 66789890-66789967 [-]
Database links

Mature sequence mmu-miR-463-5p

Accession MIMAT0002104
Previous IDsmmu-miR-463;mmu-miR-463*
Sequence

4 - 

uaccuaauuuguuguccaucau

 - 25

Get sequence
Deep sequencing14398 reads, 24 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-463-3p

Accession MIMAT0004758
Previous IDsmmu-miR-463
Sequence

41 - 

ugauagacaccauauaagguag

 - 62

Get sequence
Deep sequencing9799 reads, 24 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).