Stem-loop sequence ptc-MIR482a

AccessionMI0002397 (change log)
Previous IDsptc-MIR482
DescriptionPopulus trichocarpa miR482a stem-loop
Gene family MIPF0000403; MIR482
Literature search

8 open access papers mention ptc-MIR482a
(133 sentences)

Stem-loop
        c   c    cuu     a      -    u           ----       
5' gaguc uag aagu   uggag ugggag agua gcaagaaggaa    aaauuc 
   ||||| ||| ||||   ||||| |||||| |||| |||||||||||    ||||| a
3' cucag guc uucg   accuu acccuc ucau cguucuuccuu    uuuagu 
        c   u    ucu     -      c    c           auaa       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 8028049-8028155 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR482a
ptc-MIR482aCM000344.2: 8028049-8028155 [+]
ptc-MIR1448CM000344.2: 8028236-8028320 [+]
Database links

Mature sequence ptc-miR482a.2

Accession MIMAT0006785
Previous IDsptc-miR482.2
Sequence

68 - 

ucuugccuacuccucccauu

 - 87

Get sequence
Evidence experimental; cloned [2]

Mature sequence ptc-miR482a.1

Accession MIMAT0002103
Previous IDsptc-miR482;ptc-miR482.1
Sequence

73 - 

ccuacuccucccauucc

 - 89

Get sequence
Evidence experimental; cloned [1], PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:18363789 "Stress-responsive microRNAs in Populus" Lu S, Sun YH, Chiang VL Plant J. 55:131-151(2008).