Stem-loop sequence ptc-MIR481b

AccessionMI0002393 (change log)
DescriptionPopulus trichocarpa miR481b stem-loop
Gene family MIPF0000131; MIR481
Literature search

1 open access papers mention ptc-MIR481b
(1 sentences)

Stem-loop
   ---a  cu    c ---   -     c          a      u  gau      uu  c     aucagagccuugauaaccaaguggucucgaguuugaaucucaucaucc 
5'     uc  agga c   uca cuuaa agcuuaagcu uugggu ga   gguucu  ga augau                                                u
       ||  |||| |   ||| ||||| |||||||||| |||||| ||   ||||||  || |||||                                                c
3'     ag  ucuu g   agu ggguu ucgaauucga aaucca cu   ccaagg  uu uacua                                                a
   uuac  uu    a uaa   u     a          c      -  ---      uc  a     aauauaauaagagauuguguggggaaauucauaaaaaauaguuuauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR481b

Accession MIMAT0002099
Sequence

6 - 

aggaccucacuuaacagcuuaagc

 - 29

Get sequence
Evidence experimental; PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).