Stem-loop sequence ptc-MIR478n

AccessionMI0002388 (change log)
DescriptionPopulus trichocarpa miR478n stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478n
(1 sentences)

Stem-loop
   ucuccuuuuuagggauaaacgucaauauuuuagacga   u     uuuu    -   ug    cau 
5'                                      guc ccuaa    uagg gac  augu   u
                                        ||| |||||    |||| |||  ||||    
3'                                      cag ggauu    aucc cug  ugca   u
   ------------------------------------c   -     -uuu    u   --    auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR478n

Accession MIMAT0002094
Sequence

70 - 

uaacgugucuccuauuuuuaggga

 - 93

Get sequence
Evidence by similarity; MI0002370

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).