Stem-loop sequence ptc-MIR478j

AccessionMI0002378 (change log)
DescriptionPopulus trichocarpa miR478j stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478j
(1 sentences)

Stem-loop
   a   u     uuuu    -   ug      u 
5'  guc ccuaa    uagg gac  auguua u
    ||| |||||    |||| |||  ||||||  
3'  cag ggauu    aucc cug  ugcaau u
   c   -     -uuu    u   --      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 16456537-16456595 [+]
intergenic
Database links

Mature sequence ptc-miR478j

Accession MIMAT0002084
Sequence

34 - 

uaacgugucuccuauuuuuaggga

 - 57

Get sequence
Evidence by similarity; MI0002370

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).