Stem-loop sequence ptc-MIR478d

AccessionMI0002373 (change log)
DescriptionPopulus trichocarpa miR478d stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478d
(1 sentences)

Stem-loop
   ---------------agccuaauc        uccu   uuua      ga   uaac 
5'                         gacguguc    acu    ggguug  cgu    u
                           ||||||||    |||    ||||||  |||     
3'                         cuguacag    uga    uccgau  gua    u
   guuagaaccaaugauuuuuaucuu        ---u   ----      aa   uuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 13828473-13828568 [+]
intergenic
Database links

Mature sequence ptc-miR478d

Accession MIMAT0002079
Sequence

64 - 

ugacaugucuucuauuuuuaguaa

 - 87

Get sequence
Evidence experimental; cloned [1], PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).