Stem-loop sequence ptc-MIR478a

AccessionMI0002370 (change log)
DescriptionPopulus trichocarpa miR478a stem-loop
Gene family MIPF0000052; MIR478
Literature search

1 open access papers mention ptc-MIR478a
(1 sentences)

Stem-loop
   --c     ---uu     uuaaa       cauuuu g  g       ua 
5'    ucccu     uaggg     acgucaa      a ac agucucu  u
      |||||     |||||     |||||||      | || |||||||  u
3'    aggga     aucuu     ugcaguu      u ug ucaggga  u
   guc     uuuuu     --cug       uuuuau g  g       uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 7133508-7133603 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR478a
ptc-MIR478bCM000348.2: 7130082-7130177 [-]
ptc-MIR478aCM000348.2: 7133508-7133603 [+]
Database links

Mature sequence ptc-miR478a

Accession MIMAT0002076
Sequence

70 - 

ugacgugucuucuauuuuuaggga

 - 93

Get sequence
Evidence experimental; cloned [1], PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).