Stem-loop sequence ptc-MIR476a

AccessionMI0002365 (change log)
DescriptionPopulus trichocarpa miR476a stem-loop
Gene family MIPF0000166; MIR476
Literature search

3 open access papers mention ptc-MIR476a
(11 sentences)

Stem-loop
   ---uua         -  cu                u     uuuuccu 
5'       agcuaguaa uc  ucuuugcaaagucauu auuau       u
         ||||||||| ||  |||||||||||||||| |||||        
3'       ucgaucauu ag  agaaacguuucaguaa uaaua       c
   ucuaaa         u  au                c     ucauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000355.2: 15352174-15352269 [-]
intergenic
Database links

Mature sequence ptc-miR476a

Accession MIMAT0002071
Sequence

7 - 

uaguaauccuucuuugcaaag

 - 27

Get sequence
Evidence experimental; cloned [1], Northern [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).