Stem-loop sequence ptc-MIR475d

AccessionMI0002364 (change log)
DescriptionPopulus trichocarpa miR475d stem-loop
Gene family MIPF0000145; MIR475
Literature search

2 open access papers mention ptc-MIR475d
(10 sentences)

Stem-loop
   a       c          c a          a  -----    -  c   aag 
5'  uaacauc ugaucaaugg c uuguaagagu ga     agga uc aug   c
    ||||||| |||||||||| | |||||||||| ||     |||| || |||    
3'  auuguag auuaguuacc g gacauucuca cu     uccu ag uac   a
   -       a          u a          c  uauag    c  u   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 7964193-7964295 [-]
intergenic
Database links

Mature sequence ptc-miR475d-5p

Accession MIMAT0022917
Sequence

15 - 

aauggccauuguaagaguaga

 - 35

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR475d-3p

Accession MIMAT0002070
Previous IDsptc-miR475d
Sequence

77 - 

uuacagaguccauugauuaag

 - 97

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).