Stem-loop sequence ptc-MIR475a

AccessionMI0002361 (change log)
DescriptionPopulus trichocarpa miR475a stem-loop
Gene family MIPF0000145; MIR475
Literature search

2 open access papers mention ptc-MIR475a
(10 sentences)

Stem-loop
                  c            a    gau   u  agcaauaauucucuuugcua 
5' caucuugaucaaugg cauuguaagagu gaag   cca ga                    a
   ||||||||||||||| |||||||||||| ||||   ||| ||                     
3' guagaauuaguuacc gugacauucuca cuuu   ggu cu                    a
                  c            -    -au   c  caguuacaaaauagugugua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000353.2: 1876687-1876810 [+]
intergenic
Database links

Mature sequence ptc-miR475a-5p

Accession MIMAT0022915
Sequence

11 - 

aauggccauuguaagaguaga

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR475a-3p

Accession MIMAT0002067
Previous IDsptc-miR475a
Sequence

101 - 

uuacagugcccauugauuaag

 - 121

Get sequence
Evidence experimental; cloned [1], Northern [1], miRNAseq [2]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).