Stem-loop sequence ptc-MIR474a

AccessionMI0002358 (change log)
DescriptionPopulus trichocarpa miR474a stem-loop
Gene family MIPF0000215; MIR474
Literature search

1 open access papers mention ptc-MIR474a
(1 sentences)

Stem-loop
   -uc    a u      guu   cu   c   cggacccaaugcuauugggu 
5'    caaa g ugcugg   ugg  ggg agg                    u
      |||| | ||||||   |||  ||| |||                    c
3'    guuu c acgacc   auc  cuc ucc                    a
   aaa    c c      acu   uu   u   uuucuucacaacccaggacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 22284795-22284898 [+]
intergenic
Database links

Mature sequence ptc-miR474a

Accession MIMAT0002064
Sequence

3 - 

caaaaguugcuggguuuggcuggg

 - 26

Get sequence
Evidence experimental; cloned [1], PCR [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).