Stem-loop sequence ptc-MIR408

AccessionMI0002352 (change log)
DescriptionPopulus trichocarpa miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

5 open access papers mention ptc-MIR408
(21 sentences)

Stem-loop
   a   a  g u aaga       c      a      a        cu     aa 
5'  gag ca a g    cggggaa aggcag gcaugg uggagcua  aacag  g
    ||| || | |    ||||||| |||||| |||||| ||||||||  |||||   
3'  cuc gu u c    gucccuu uccguc cguacc aucucggu  uuguu  u
   -   g  g u ---g       c      a      c        -u     ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 14802196-14802300 [+]
intergenic
Database links

Mature sequence ptc-miR408-5p

Accession MIMAT0022913
Sequence

16 - 

cggggaacaggcagagcaugg

 - 36

Get sequence
Evidence experimental; miRNAseq [5]

Mature sequence ptc-miR408-3p

Accession MIMAT0002058
Previous IDsptc-miR408
Sequence

76 - 

augcacugccucuucccuggc

 - 96

Get sequence
Evidence experimental; cloned [1], miRNAseq [5]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
3
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
4
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
5
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).