Stem-loop sequence ptc-MIR399j

Accession

MI0002347

Description

Populus trichocarpa miR399j stem-loop

Gene family

MIPF0000015; MIR399

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-399_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-399 is a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-399 is thought to target mRNAs coding for a phosphate transporter. The mature sequence is excised from the 3' arm of the hairpin. There are multiple copies of MIR399 in each plant genome, for example A. thaliana contains six microRNA precursors that all give rise to an almost identical mature miR-399 sequence.

Stem-loop

--------   auuaca       ac    a        ca  -    --    c      uu 
        ugc      gggcaag  cucc uuggcagg  gc cacu  aaag augcau  a
        |||      |||||||  |||| ||||||||  || ||||  |||| ||||||  a
        acg      ccuguuu  gagg aaccgucu  cg guga  uuuc ugcgua  a
ucuucuaa   -----g       -a    a        cc  u    au    u      uu 

Genome context

• Coordinates (JGI_Poptr2.0): scaffold_11: 7754550-7754661 [+]
• Overlapping transcripts:

  intergenic

Mature sequence ptc-miR399j

• Accession: MIMAT0002053
• Sequence: 82 - ugccaaaggagauuuguccgg - 102
• Evidence: by similarity; MI0001020

References

1. PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).