Stem-loop sequence ptc-MIR399i

AccessionMI0002346 (change log)
DescriptionPopulus trichocarpa miR399i stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention ptc-MIR399i
(9 sentences)

Stem-loop
   aaac    ug       c     ac        -  a   u    ----g     a 
5'     cagu  uagggua cucuu  uuggcaag ca ugg gauu     uugca a
       ||||  ||||||| |||||  |||||||| || ||| ||||     ||||| c
3'     guca  aucccgu gagag  aaccguuc gu gcu cuag     gacgu a
   -uuu    gu       u     ga        u  g   -    uuuaa     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 13767450-13767557 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR399i
ptc-MIR399iCM000348.2: 13767450-13767557 [-]
ptc-MIR399hCM000348.2: 13760890-13761021 [-]
Database links

Mature sequence ptc-miR399i

Accession MIMAT0002052
Sequence

79 - 

ugccaaaggagaguugcccua

 - 99

Get sequence
Evidence by similarity; MI0001022

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).