Stem-loop sequence ptc-MIR399h

AccessionMI0002345 (change log)
DescriptionPopulus trichocarpa miR399h stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention ptc-MIR399h
(9 sentences)

Stem-loop
       ca  ug     cac       cc      gacaguacuaauggugccuauagcuucaagcug 
5' aaac  gu  caggg   cucucuu  uuggca                                 a
   ||||  ||  |||||   |||||||  ||||||                                 g
3' uuug  ca  guccc   gagagga  aaccgu                                 a
       -c  gu     uuu       --      ucggauauaacccuaguucuaagagcguauggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 13760890-13761021 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR399h
ptc-MIR399iCM000348.2: 13767450-13767557 [-]
ptc-MIR399hCM000348.2: 13760890-13761021 [-]
Database links

Mature sequence ptc-miR399h

Accession MIMAT0002051
Sequence

103 - 

ugccaaaggagaguuucccug

 - 123

Get sequence
Evidence by similarity; MI0001021

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).