Stem-loop sequence ptc-MIR399f

AccessionMI0002343 (change log)
DescriptionPopulus trichocarpa miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention ptc-MIR399f
(9 sentences)

Stem-loop
   uaaa    aa      uuu  c             -     cauggaaaua 
5'     gaau  cagggc   au cuccuuuggcaaa cagaa          a
       ||||  ||||||   || ||||||||||||| |||||          a
3'     cuua  gucccg   ua gaggaaaccguuu gucuu          u
   -uag    cc      --u  a             u     uauacguccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 4599656-4599756 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR399f
ptc-MIR399aCM000340.2: 4598194-4598313 [-]
ptc-MIR399fCM000340.2: 4599656-4599756 [+]
Database links

Mature sequence ptc-miR399f

Accession MIMAT0002049
Sequence

72 - 

ugccaaaggagaauugcccug

 - 92

Get sequence
Evidence by similarity; MI0001023

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).