Stem-loop sequence ptc-MIR398c

AccessionMI0002337 (change log)
DescriptionPopulus trichocarpa miR398c stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention ptc-MIR398c
(14 sentences)

Stem-loop
   aggau   ua    a         aau       gg   g ------    u 
5'      ucc  cagg gcgaccuga   cacaugu  gcu c      accc c
        |||  |||| |||||||||   |||||||  ||| |      ||||  
3'      ggg  gucc cgcuggacu   guguaca  cga g      uggg c
   -uuuc   cc    c         cuu       -a   - uucuau    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000345.2: 6795749-6795845 [-]
intergenic
Database links

Mature sequence ptc-miR398c-5p

Accession MIMAT0022912
Sequence

13 - 

ggagcgaccugaaaucacaug

 - 33

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR398c-3p

Accession MIMAT0002043
Previous IDsptc-miR398c
Sequence

68 - 

uguguucucaggucgccccug

 - 88

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).