Stem-loop sequence ptc-MIR398a

AccessionMI0002335 (change log)
DescriptionPopulus trichocarpa miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

5 open access papers mention ptc-MIR398a
(14 sentences)

Stem-loop
   guaca         a      cca            -----g   g     c    u 
5'      ccccagagg guggcu   gagaacacaggg      guu guuuu uagc g
        ||||||||| ||||||   ||||||||||||      ||| ||||| |||| u
3'      gggguuucc cacugg   cucuugugucuc      cag uagaa aucg a
   -ccac         c      --a            acgaaa   g     c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000346.2: 15683184-15683292 [+]
intergenic
Database links

Mature sequence ptc-miR398a

Accession MIMAT0002041
Sequence

80 - 

uguguucucaggucaccccuu

 - 100

Get sequence
Evidence by similarity; MI0001017

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).