Stem-loop sequence ptc-MIR397b

AccessionMI0002333 (change log)
DescriptionPopulus trichocarpa miR397b stem-loop
Gene family MIPF0000120; MIR397
Literature search

2 open access papers mention ptc-MIR397b
(3 sentences)

Stem-loop
   uaauuau   cca               a      ucucuuguuagcuuacuuagcu 
5'        aca   uugagugcagcguug ugaaau                      a
          |||   ||||||||||||||| ||||||                       
3'        ugu   aacuuacgucgcgac acuuua                      u
   --cuuuu   acc               c      cuaaggugcgguagcacucuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000340.2: 2207873-2207986 [+]
intergenic
Database links

Mature sequence ptc-miR397b

Accession MIMAT0002039
Sequence

11 - 

ccauugagugcagcguugaug

 - 31

Get sequence
Evidence by similarity; MI0001016

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).