Stem-loop sequence ptc-MIR396g

AccessionMI0002331 (change log)
DescriptionPopulus trichocarpa miR396g stem-loop
Gene family MIPF0000047; MIR396
Literature search

7 open access papers mention ptc-MIR396g
(18 sentences)

Stem-loop
   uug    c                   a   g c   c       a   gaguaaagggcuaggcuuucuuuucuauuccuuuc 
5'    caug uuuuccacggcuuucuuga cuu g acu aagagac uga                                   g
      |||| ||||||||||||||||||| ||| | ||| ||||||| |||                                   u
3'    guau aaagggugccgaaagaacu gaa c uga uucucug acu                                   u
   --a    a                   c   a a   u       -   auacauaccuaagaaacuuguccuuuuaaaguuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000343.2: 6411634-6411801 [-]
intergenic
Database links

Mature sequence ptc-miR396g-5p

Accession MIMAT0002037
Previous IDsptc-miR396g
Sequence

11 - 

uuccacggcuuucuugaacuu

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR396g-3p

Accession MIMAT0022911
Sequence

143 - 

cucaagaaagccgugggaaaa

 - 163

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).