Stem-loop sequence ptc-MIR396f

AccessionMI0002330 (change log)
DescriptionPopulus trichocarpa miR396f stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention ptc-MIR396f
(13 sentences)

Stem-loop
   cuu         c  c                auauauuau    gg      a  agac      a 
5'    ggugauuuu ca ggcuuucuugaacugu         caau  cuuuuu ca    uggaag u
      ||||||||| || ||||||||||||||||         ||||  |||||| ||    ||||||  
3'    uuauuaaaa gu ccgaaagaacuugaca         guua  gaagag gu    accuuu g
   --u         a  c                -aaaacacu    -a      -  ----      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 25199401-25199527 [-]
intergenic
Database links

Mature sequence ptc-miR396f

Accession MIMAT0002036
Sequence

11 - 

uuccacggcuuucuugaacug

 - 31

Get sequence
Evidence by similarity; MI0001702

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).