Stem-loop sequence ptc-MIR396d

AccessionMI0002328 (change log)
DescriptionPopulus trichocarpa miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention ptc-MIR396d
(14 sentences)

Stem-loop
             ----      c        a          a    cu  cca    uaa  u  -gu         gauc       a 
5' gaaaguccug    gucaug uuuuccac gcuuucuuga cuuc  ug   ugcu   cu gu   guguguaua    acuauau u
   ||||||||||    |||||| |||||||| |||||||||| ||||  ||   ||||   || ||   |||||||||    |||||||  
3' uuuuuaggac    cgguac agagggug cgaaagaacu gaag  ac   acga   ga cg   uacacauau    ugauaug c
             ucaa      a        c          c    uu  --c    -uc  u  auu         ----       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 4642885-4643050 [-]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR396d
ptc-MIR396dCM000342.2: 4642885-4643050 [-]
ptc-MIR396aCM000342.2: 4636167-4636289 [+]
Database links

Mature sequence ptc-miR396d

Accession MIMAT0002034
Sequence

20 - 

uuccacagcuuucuugaacuu

 - 40

Get sequence
Evidence by similarity; MI0001014

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).