Stem-loop sequence ptc-MIR396c

AccessionMI0002327 (change log)
DescriptionPopulus trichocarpa miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention ptc-MIR396c
(13 sentences)

Stem-loop
   ugc      u      a               -----------------    ---a   u 
5'    cauguu uuccac gcuuucuugaacuuc                 cuag    gcc a
      |||||| |||||| |||||||||||||||                 ||||    |||  
3'    guacga aaggug cgaaagaacuugaag                 gauc    ugg g
   --a      u      c               aauucaauauacauauc    gucg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000339.2: 15576014-15576115 [+]
intergenic
Database links

Mature sequence ptc-miR396c

Accession MIMAT0002033
Sequence

11 - 

uuccacagcuuucuugaacuu

 - 31

Get sequence
Evidence by similarity; MI0001014

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).