Stem-loop sequence ptc-MIR396b

AccessionMI0002326 (change log)
DescriptionPopulus trichocarpa miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention ptc-MIR396b
(13 sentences)

Stem-loop
   cu      uc            c          c -uauua  --u       g    u  ug  c a 
5'   uuguau  uuccacagcuuu uugaacugca c      ga   uaauguu augu gu  ug g u
     ||||||  |||||||||||| |||||||||| |      ||   ||||||| |||| ||  || | a
3'   aacaua  agggugucgaaa aacuuggcgu g      cu   guuacag uaua ca  ac c u
   --      ga            u          c uuuuua  uau       -    c  gu  - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR396b

Accession MIMAT0002032
Sequence

11 - 

uuccacagcuuucuugaacug

 - 31

Get sequence
Evidence by similarity; MI0001013

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).