|
miRBase |
|
Stem-loop sequence ptc-MIR395i |
||||||||
| Accession | MI0002323 | |||||||
| Description | Populus trichocarpa miR395i stem-loop | |||||||
| Gene family | MIPF0000016; MIR395 | |||||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases. |
|||||||
| Stem-loop |
g u c ua ug a --------- c uc ug c cc gaguuccuc agcacuuca ugggga ucuu ca g || | || ||||||||| ||||||||| |||||| |||| || ac g gg cucaagggg uugugaagu auccuu agaa gu a - u u uc gu c acuauuaug a cc |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
Mature sequence ptc-miR395i |
|
| Accession | MIMAT0002029 |
| Sequence |
73 - cugaaguguuugggggaacuc - 93 |
| Evidence | by similarity; MI0001010 |
References |
|
| 1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
| 2 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|