Stem-loop sequence ptc-MIR395h

AccessionMI0002322 (change log)
DescriptionPopulus trichocarpa miR395h stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention ptc-MIR395h
(7 sentences)

Stem-loop
   g  u c  ua         ug         u      ---------    c  uc 
5'  ug c cc  gaguuccuc  agcacuuca ugggga         ucuu ca  g
    || | ||  |||||||||  ||||||||| ||||||         |||| ||   
3'  ac g gg  cucaagggg  uugugaagu auccuu         agaa gu  a
   -  u u  uc         gu         c      acuauuaug    a  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ptc-miR395h

Accession MIMAT0002028
Sequence

73 - 

cugaaguguuugggggaacuc

 - 93

Get sequence
Evidence by similarity; MI0001010

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).