Stem-loop sequence ptc-MIR395g

AccessionMI0002321 (change log)
DescriptionPopulus trichocarpa miR395g stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention ptc-MIR395g
(7 sentences)

Stem-loop
   g  u c  ua         ug         u      ---------    c  uc 
5'  ug c cc  gaguuccuc  agcacuuca ugggga         ucuu ca  g
    || | ||  |||||||||  ||||||||| ||||||         |||| ||   
3'  ac g gg  cucaagggg  uugugaagu auccuu         agaa gu  a
   -  u u  uc         gu         c      acuauuaug    a  cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000352.2: 13793446-13793547 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR395g
ptc-MIR395eCM000352.2: 13792278-13792390 [-]
ptc-MIR395gCM000352.2: 13793446-13793547 [+]
ptc-MIR395iCM000352.2: 13797871-13797972 [+]
Database links

Mature sequence ptc-miR395g

Accession MIMAT0002027
Sequence

73 - 

cugaaguguuugggggaacuc

 - 93

Get sequence
Evidence by similarity; MI0001010

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).