Stem-loop sequence ptc-MIR395c

AccessionMI0002317 (change log)
DescriptionPopulus trichocarpa miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention ptc-MIR395c
(7 sentences)

Stem-loop
   g  u c  ua         ug         u      ucuucgauuaaau 
5'  ug c cc  gaguuccuc  agcacuuca ugggaa             g
    || | ||  |||||||||  ||||||||| ||||||              
3'  ac g gg  cucaagggg  uugugaagu auccuu             a
   -  u u  uc         gu         c      acuauuaugagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 8406701-8406801 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR395c
ptc-MIR395cCM000342.2: 8406701-8406801 [+]
ptc-MIR395dCM000342.2: 8410822-8410922 [+]
Database links

Mature sequence ptc-miR395c

Accession MIMAT0002023
Sequence

72 - 

cugaaguguuugggggaacuc

 - 92

Get sequence
Evidence by similarity; MI0001010

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).