Stem-loop sequence ptc-MIR395c

Accession MI0002317
Description Populus trichocarpa miR395c stem-loop
Gene family MIPF0000016; MIR395
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g  u c  ua         ug         u      ucuucgauuaaau 
 ug c cc  gaguuccuc  agcacuuca ugggaa             g
 || | ||  |||||||||  ||||||||| ||||||              
 ac g gg  cucaagggg  uugugaagu auccuu             a
-  u u  uc         gu         c      acuauuaugagaa 
Get sequence
Genome context
Coordinates (JGI_Poptr2.0) Overlapping transcripts
scaffold_6: 8406701-8406801 [+]
intergenic
Clustered miRNAs
< 10kb from ptc-MIR395c
ptc-MIR395c scaffold_6: 8406701-8406801 [+]
ptc-MIR395d scaffold_6: 8410822-8410922 [+]

Mature sequence ptc-miR395c

Accession MIMAT0002023
Sequence

72 - 

cugaaguguuugggggaacuc

 - 92

Get sequence
Evidence by similarity; MI0001010

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).