Stem-loop sequence ptc-MIR395b

Accession

MI0002316

Description

Populus trichocarpa miR395b stem-loop

Gene family

MIPF0000016; MIR395

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-395_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

mir-395 is a non-coding RNA called a microRNA that was identified in both Arabidopsis thaliana and Oryza sativa computationally and was later experimentally verified. mir-395 is thought to target mRNAs coding for ATP sulphurylases. The mature sequence is excised from the 3' arm of the hairpin. miR-395 is upregulated in Arabidopsis during sulphate-limited conditions, when the mature miRNA then regulates sulphur transporters and ATP sulphurylases.

Stem-loop

g  u c  ua         ug         c     cccuucag  - g 
 ug c cc  gaguucccu  agcacuuca uggga        ac c a
 || | ||  |||||||||  ||||||||| |||||        || |  
 ac g gg  cucaagggg  uugugaagu acccu        ug g a
-  u u  uc         gu         c     uucuauua  a a 

Genome context

• Coordinates (JGI_Poptr2.0): scaffold_6: 7424410-7424507 [+]
• Overlapping transcripts:

  intergenic

Mature sequence ptc-miR395b

• Accession: MIMAT0002022
• Sequence: 69 - cugaaguguuugggggaacuc - 89
• Evidence: by similarity; MI0001010

References

1. PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).