Stem-loop sequence ptc-MIR395a

AccessionMI0002315 (change log)
DescriptionPopulus trichocarpa miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

5 open access papers mention ptc-MIR395a
(7 sentences)

Stem-loop
     u    cu          u    u        cccgu   aagc          au   -     gcu   aaga       -gugu      --      -    aa       au 
5' gg cacc  gaguuccucc agcu cuucagua     gga    uaaugcuaca  uau cuuga   ggu    cuggcag     cagaug  uggaug uguu  agguaau  u
   || ||||  |||||||||| |||| ||||||||     |||    ||||||||||  ||| |||||   |||    |||||||     ||||||  |||||| ||||  |||||||  a
3' uc gugg  cucaaggagg uugg gaagucgu     ccu    auuauggugu  aua gaacu   uua    gauuguc     guuuau  acuuac gcgg  uuuauua  u
     -    au          u    -        uuagu   ---c          --   u     aau   -gga       aucuu      ga      c    ca       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000338.2: 14667284-14667509 [+]
intergenic
Database links

Mature sequence ptc-miR395a

Accession MIMAT0002021
Sequence

198 - 

cugaaggguuuggaggaacuc

 - 218

Get sequence
Evidence by similarity; MI0001012

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).