Stem-loop sequence ptc-MIR393c

AccessionMI0002311 (change log)
DescriptionPopulus trichocarpa miR393c stem-loop
Gene family MIPF0000083; MIR393
Literature search

3 open access papers mention ptc-MIR393c
(6 sentences)

Stem-loop
   gcu    u     a            u          cucuc  ugu     u   a 
5'    ggag guucc aagggaucgcau gaucuaauga     ga   cuaaa cau u
      |||| ||||| |||||||||||| ||||||||||     ||   ||||| |||  
3'    ccuu uaagg uucccuagcgua cuagguugcu     uu   gauuu gua u
   --a    u     a            -          -----  uuu     -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 13166756-13166862 [+]
intergenic
Database links

Mature sequence ptc-miR393c

Accession MIMAT0002017
Sequence

11 - 

uccaaagggaucgcauugauc

 - 31

Get sequence
Evidence by similarity; MI0001004

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).