Stem-loop sequence ptc-MIR393a

AccessionMI0002309 (change log)
DescriptionPopulus trichocarpa miR393a stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention ptc-MIR393a
(12 sentences)

Stem-loop
   ag      c            c    u     c    guc  u 
5'   aggagg auccaaagggau gcau gaucc aagu   ug c
     |||||| |||||||||||| |||| ||||| ||||   || c
3'   uccucc uagguuucccua cgua cuagg uuua   ac c
   --      u            u    -     u    -au  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 3747076-3747160 [+]
intergenic
Database links

Mature sequence ptc-miR393a-5p

Accession MIMAT0002015
Previous IDsptc-miR393a
Sequence

11 - 

uccaaagggaucgcauugauc

 - 31

Get sequence
Evidence experimental; miRNAseq [2]

Mature sequence ptc-miR393a-3p

Accession MIMAT0022908
Sequence

59 - 

aucaugcuaucccuuuggauu

 - 79

Get sequence
Evidence experimental; miRNAseq [2]

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
2
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).