Stem-loop sequence ptc-MIR390c

AccessionMI0002307 (change log)
DescriptionPopulus trichocarpa miR390c stem-loop
Gene family MIPF0000101; MIR390
Literature search

5 open access papers mention ptc-MIR390c
(22 sentences)

Stem-loop
   ag       ua         g          auga         a  -     guu  a    u 
5'   gaucugu  agcucagga ggauagcgcc    gcugaugau ag uugau   ug uggg u
     |||||||  ||||||||| ||||||||||    ||||||||| || |||||   || |||| a
3'   uuggaua  uugaguccu ucuaucgcgg    ugauuacug uc aacua   ac acuc a
   --       uc         a          ----         a  u     -au  a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000345.2: 7516332-7516454 [+]
intergenic
Database links

Mature sequence ptc-miR390c

Accession MIMAT0002013
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence by similarity; MI0001001

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).