Stem-loop sequence ptc-MIR390b

AccessionMI0002306 (change log)
DescriptionPopulus trichocarpa miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

4 open access papers mention ptc-MIR390b
(13 sentences)

Stem-loop
   agaaucuguu          g          -  a    uaa   ug    - uu 
5'           aagcucagga ggauagcgcc cu agga   uca  ggcu c  u
             |||||||||| |||||||||| || ||||   |||  |||| |  u
3'           uuugaguccu ccuaucgcgg ga ucuu   agu  uugg g  u
   --uucguuac          a          u  c    ---   uu    u ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000342.2: 7867985-7868090 [+]
intergenic
Database links

Mature sequence ptc-miR390b

Accession MIMAT0002012
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence by similarity; MI0001001

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).