Stem-loop sequence ptc-MIR319h

AccessionMI0002303 (change log)
DescriptionPopulus trichocarpa miR319h stem-loop
Gene family MIPF0000010; MIR159
Literature search

8 open access papers mention ptc-MIR319h
(30 sentences)

Stem-loop
   uugua  ---g    aagu                 aa  a    u   -aa    cua  ---   g    cu         a   aau      ca   gg 
5'      gg    gcua    gcuccuuuuaguccaau  gg gggc gag   gcgg   ga   gcu ccau  caugcauuu ggc   gcuuaa  uuu  c
        ||    ||||    |||||||||||||||||  || |||| |||   ||||   ||   ||| ||||  ||||||||| |||   ||||||  |||   
3'      cc    uggu    cgagggaagucagguua  cc cuug uuc   cgcc   cu   cga ggug  guacgugga ccg   cgaauu  gag  a
   ---ca  auuu    -ccu                 -c  g    u   gua    uuc  caa   g    ug         -   guu      ug   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000351.2: 7395415-7395609 [+]
intergenic
Database links

Mature sequence ptc-miR319h

Accession MIMAT0002009
Sequence

165 - 

uuggacugaagggagcuccu

 - 184

Get sequence
Evidence by similarity; MI0002298

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).