Stem-loop sequence ptc-MIR319g

AccessionMI0002302 (change log)
DescriptionPopulus trichocarpa miR319g stem-loop
Gene family MIPF0000010; MIR159
Literature search

8 open access papers mention ptc-MIR319g
(30 sentences)

Stem-loop
   uaaucgu     a             c   cu  ug  -u    caaa     u   --cuag  g   ac        u   g   u     a    a     a 
5'        gggag gagcuucuuucag cca  cg  ga  agga    ggggu gaa      cu ccg  ucauucau caa cac aguag aaaa aggcg a
          ||||| ||||||||||||| |||  ||  ||  ||||    ||||| |||      || |||  |||||||| ||| ||| ||||| |||| ||||| c
3'        ccuuc cucgagggaaguc ggu  gu  cu  uccu    uccua cuu      ga ggc  aguaagug guu gug ucauc uuuu uuugu g
   -ucucuu     -             a   uc  gu  uu    ---c     c   uuaaua  g   gu        u   a   -     g    c     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000355.2: 10665338-10665541 [+]
intergenic
Database links

Mature sequence ptc-miR319g

Accession MIMAT0002008
Sequence

176 - 

uuggacugaagggagcuccu

 - 195

Get sequence
Evidence by similarity; MI0002298

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).