Stem-loop sequence ptc-MIR319f

AccessionMI0002301 (change log)
DescriptionPopulus trichocarpa miR319f stem-loop
Gene family MIPF0000010; MIR159
Literature search

8 open access papers mention ptc-MIR319f
(30 sentences)

Stem-loop
   ua    -u     a             c   cu      u      aa    ---uu      g  g   ac        u   g   c     aaaa        g 
5'   augg  gggag gagcuuccuucag cca  caugga aggaga  gggg     gaauua cu ccg  ucauucau caa cac aguag    aggggaau g
     ||||  ||||| ||||||||||||| |||  |||||| ||||||  ||||     |||||| || |||  |||||||| ||| ||| |||||    ||||||||  
3'   uauc  ccuuc cucgagggaaguc ggu  gugucu uuuucu  cccc     uuuaau ga ggc  aguaagug guu gug ucauc    uuuucuua a
   --    uu     -             a   uc      -      --    uacau      a  g   gu        u   a   -     ---g        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000349.2: 8843265-8843466 [+]
intergenic
Database links

Mature sequence ptc-miR319f

Accession MIMAT0002007
Sequence

174 - 

uuggacugaagggagcuccu

 - 193

Get sequence
Evidence by similarity; MI0002298

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).