Stem-loop sequence ptc-MIR319e

AccessionMI0002300 (change log)
DescriptionPopulus trichocarpa miR319e stem-loop
Gene family MIPF0000010; MIR159
Literature search

8 open access papers mention ptc-MIR319e
(30 sentences)

Stem-loop
     ag     g   u                 ac  a    u   -aa    cua  ---   g    cu      uuua   aau       --a   g 
5' gg  gggcu agg gcuccuuuuaguccaau  gg gggc gag   gcgg   ga   gcu ccau  caugca    ggc   gcuuaac   uuu a
   ||  ||||| ||| |||||||||||||||||  || |||| |||   ||||   ||   ||| ||||  ||||||    |||   |||||||   ||| c
3' cc  uuugg ucc cgagggaagucagguua  cc cucg uuc   cgcc   cu   cga ggug  guacgu    ccg   cgaauug   aga g
     au     -   u                 -c  g    u   gua    uuc  caa   g    ug      -uca   guu       gag   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000348.2: 4980083-4980274 [-]
intergenic
Database links

Mature sequence ptc-miR319e

Accession MIMAT0002006
Sequence

164 - 

uuggacugaagggagcuccu

 - 183

Get sequence
Evidence by similarity; MI0002298

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).