Stem-loop sequence ptc-MIR319d

AccessionMI0002299 (change log)
DescriptionPopulus trichocarpa miR319d stem-loop
Gene family MIPF0000010; MIR159
Literature search

8 open access papers mention ptc-MIR319d
(30 sentences)

Stem-loop
   a ug   u  ca                 cu      cg  c       uu       -  g   ac        u  aa        aca  ga  g 
5'  a  guu aa  gagcuuccuucagucca  caugga  gg gaagggu  ggauuag cu ccg  ucauucau ca  cacaguag   ag  gu g
    |  ||| ||  |||||||||||||||||  ||||||  || |||||||  ||||||| || |||  |||||||| ||  ||||||||   ||  ||  
3'  u  uaa uu  cucgagggaagucaggu  gugucu  uc uuuccua  uuuaauu ga ggc  aguaagug gu  guguuauc   uc  cg c
   - gu   u  cc                 uc      cu  u       -c       a  g   gc        u  aa        --g  gg  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000355.2: 15846565-15846757 [+]
intergenic
Database links

Mature sequence ptc-miR319d

Accession MIMAT0002005
Sequence

165 - 

uuggacugaagggagcuccc

 - 184

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).