Stem-loop sequence ptc-MIR172i

AccessionMI0002295 (change log)
DescriptionPopulus trichocarpa miR172i stem-loop
Literature search

8 open access papers mention ptc-MIR172i
(33 sentences)

Stem-loop
   ---a    gugaag      -a    c     g  ---g     g   -ug     g ug    aaug 
5'     ugug      gcagca  gucg ggguu uu    uuggc aaa   guucu u  guug    g
       ||||      ||||||  |||| ||||| ||    ||||| |||   ||||| |  ||||     
3'     acac      cgucgu  uagu ccuaa ag    agcug uuu   caagg a  cgau    a
   cgag    ----aa      ag    -     g  aaga     g   uga     a gu    gaga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 2531029-2531153 [+]
intergenic
Database links

Mature sequence ptc-miR172i

Accession MIMAT0002001
Sequence

97 - 

agaauccugaugaugcugcaa

 - 117

Get sequence
Evidence by similarity; MI0000216

References

1
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).