Stem-loop sequence ptc-MIR172h

AccessionMI0002294 (change log)
DescriptionPopulus trichocarpa miR172h stem-loop
Gene family MIPF0000035; MIR172
Literature search

8 open access papers mention ptc-MIR172h
(33 sentences)

Stem-loop
   cugu      a  g    c           a   ac    uuag     auaa  ggu     u  u    uu 
5'     uugccg ug agca caucaagauuc caa  uuua    ggcua    gu   gauga gg ggcu  u
       |||||| || |||| ||||||||||| |||  ||||    |||||    ||   ||||| || ||||   
3'     aacggc ac ucgu guaguucuaag guu  aagu    ccgau    ca   uugcu cc cugg  g
   -aau      g  g    a           g   --    -uua     aacc  acu     u  -    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000344.2: 3367114-3367256 [+]
intergenic
Database links

Mature sequence ptc-miR172h-5p

Accession MIMAT0022906
Sequence

13 - 

ggagcaccaucaagauucaca

 - 33

Get sequence
Evidence experimental; miRNAseq [4]

Mature sequence ptc-miR172h-3p

Accession MIMAT0002000
Previous IDsptc-miR172h
Sequence

114 - 

ggaaucuugaugaugcugcag

 - 134

Get sequence
Evidence experimental; cloned [1], miRNAseq [4]

References

1
PMID:15994906 "Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis" Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL Plant Cell. 17:2186-2203(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
4
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).