Stem-loop sequence ptc-MIR172b

AccessionMI0002288 (change log)
DescriptionPopulus trichocarpa miR172b stem-loop
Gene family MIPF0000035; MIR172
Literature search

8 open access papers mention ptc-MIR172b
(34 sentences)

Stem-loop
   uugu    g    g                a   --g    -u  -ac   c     uguua    u    uc 
5'     uugc ggug agcaucaucaagauuc cau   caaa  gc   ggc gguga     agag uaaa  u
       |||| |||| |||||||||||||||| |||   ||||  ||   ||| |||||     |||| ||||   
3'     aacg cuac ucguaguaguucuaag gug   guuu  ug   ccg cuacu     ucuu guuu  u
   -aau    g    g                a   aag    cu  aaa   u     ---ug    u    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000345.2: 1730120-1730259 [-]
intergenic
Database links

Mature sequence ptc-miR172b-5p

Accession MIMAT0022904
Sequence

13 - 

ggagcaucaucaagauucaca

 - 33

Get sequence
Evidence experimental; miRNAseq [3]

Mature sequence ptc-miR172b-3p

Accession MIMAT0001994
Previous IDsptc-miR172b
Sequence

111 - 

agaaucuugaugaugcugcau

 - 131

Get sequence
Evidence experimental; miRNAseq [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:16973872 "The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)" Tuskan GA, Difazio S, Jansson S, Bohlmann J, Grigoriev I, Hellsten U, Putnam N, Ralph S, Rombauts S, Salamov A, Schein J, Sterck L, Aerts A, Bhalerao RR, Bhalerao RP, Blaudez D, Boerjan W, Brun A, Brunner A, Busov V, Campbell M, Carlson J, Chalot M, Chapm Science. 313:1596-1604(2006).
3
PMID:22442676 "Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets" Puzey JR, Karger A, Axtell M, Kramer EM PLoS One. 7:e33034(2012).